sequence based reagent pgem t easy backbone promega rrid addgene 122563 commercial assay (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
sequence based reagent pgem t easy backbone promega rrid addgene 122563 commercial assay
Sequence Based Reagent Pgem T Easy Backbone Promega Rrid Addgene 122563 Commercial Assay, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem+t+easy+plasmid/pGEM-T+Easy-Gbait-hs-QF2+(Plasmid+%23122563)/10__7554_slash_elife__106439-335-33-41
Average 93 stars, based on 3 article reviews
Sequence Based Reagent Pgem T Easy Backbone Promega Rrid Addgene 122563 Commercial Assay, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem+t+easy+plasmid/pGEM-T+Easy-Gbait-hs-QF2+(Plasmid+%23122563)/10__7554_slash_elife__106439-335-33-41
Average 93 stars, based on 3 article reviews
sequence based reagent pgem t easy backbone promega rrid addgene 122563 commercial assay - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Cloning:Article Title: The receptor DNGR-1 signals for phagosomal rupture to promote cross-presentation of dead cell-associated antigens Article Snippet: .. The receptors were sub-cloned with the Takara In-Fusion Cloning system into the pSBbi-GH vector (Addgene) using the following primers: Primer Name Primer Sequence C7 forward CCCCAAGCTTGGCCTTTACAGTTCCTTCTCACAGA C7 reverse ACCCCAAGCTGGCCTATGAAATATCACTCTCATATAGA C9::C7 reverse ACCCCAAGCTGGCCTATGCATGCGGAAGAAATATATACC C9(Y7F)::C7 reverse ACCCCAAGCTGGCCTATGCATGCGGAAGAAATATTTACC Open in a separate window The murine β-2 microglobulin sequence in the Plasmid Preparation:Article Title: The receptor DNGR-1 signals for phagosomal rupture to promote cross-presentation of dead cell-associated antigens Article Snippet: .. The receptors were sub-cloned with the Takara In-Fusion Cloning system into the pSBbi-GH vector (Addgene) using the following primers: Primer Name Primer Sequence C7 forward CCCCAAGCTTGGCCTTTACAGTTCCTTCTCACAGA C7 reverse ACCCCAAGCTGGCCTATGAAATATCACTCTCATATAGA C9::C7 reverse ACCCCAAGCTGGCCTATGCATGCGGAAGAAATATATACC C9(Y7F)::C7 reverse ACCCCAAGCTGGCCTATGCATGCGGAAGAAATATTTACC Open in a separate window The murine β-2 microglobulin sequence in the Sequencing:Article Title: The receptor DNGR-1 signals for phagosomal rupture to promote cross-presentation of dead cell-associated antigens Article Snippet: .. The receptors were sub-cloned with the Takara In-Fusion Cloning system into the pSBbi-GH vector (Addgene) using the following primers: Primer Name Primer Sequence C7 forward CCCCAAGCTTGGCCTTTACAGTTCCTTCTCACAGA C7 reverse ACCCCAAGCTGGCCTATGAAATATCACTCTCATATAGA C9::C7 reverse ACCCCAAGCTGGCCTATGCATGCGGAAGAAATATATACC C9(Y7F)::C7 reverse ACCCCAAGCTGGCCTATGCATGCGGAAGAAATATTTACC Open in a separate window The murine β-2 microglobulin sequence in the |